Genetic variations in NLRP1 and Glutathione S-Transferase are associated with Generalized Vitiligo of Phlegmatic Clinical Phenotypes in Unani Medicine Philosophy of South Indian Population

Alokananda Chakraborty¹*, Priyanka Pallapolu¹, Seelamneni Thulasamma¹, Lahari Kuna¹,

Shravan Kumar Ghali¹, Kaiser Jamil², Ghazala Javed³, Munawwar Husain Kazmi¹.

¹BCMB Laboratory, National Research Institute of Unani Medicine for Skin Disorders, 

ESI x Road, Hyderabad, Telangana, India.

²Bhagwan Mahavir Medical Research Centre, 10-1-1, Mahavir Marg, Hyderabad - 500004, Telangana, India.

³Central Council for Research in Unani Medicine (CCRUM), New Delhi, India.

*Corresponding Author E-mail: alokananda.lahiri@gmail.com

ABSTRACT:

Background: Generalized vitiligo is a common, multifaceted, polygenic condition in which autoimmune loss of melanocytes results in depigmented skin patches, overlying hair and mucous membranes. NLRP1 has been proposed to be implicated in the susceptibility of a broad variety of autoimmune disorders, including generalized vitiligo (GV). Genetic polymorphisms in the NLRP1 encoding gene (formerly known as NALP1) have previously been found to be linked with GV and there is uncertainty as to their role in the modulation of NLRP1 expression. Oxidative stress is a significant pathogenesis theory for vitiligo. Glutathione S-transferases (GSTs) are enzymes active in the defense of cells against chemical toxicity and stress.This study validates some of the Unani concepts of humors or temperaments (Phenotypes), with regard to Vitiligo, Where vitiligo is regarded as a phlegmatic disease. We selected Vitiligo subjects with Phlegmatic Clinical Phenotype for our study, with an aim to determine its association with the genetic biomarkers- NLRP1, GSTM1 and GSTT1 null genotypes and other biochemical parameters. Methods: The Unani clinicians randomly selected 100 vitiligo patients with a phlegmatic Clinical Phenotype who were attending NRIUMSD for treatment and 100 healthy volunteers belonging to Phlegmatic (Phlegmatic clinical Phenotype). Besides looking at temperaments/ humors as susceptibility factors – we included a genetic factor- NLRP1, GSTM1- and GSTT1-null genotypes to our investigation. We have genotyped the NLRP1, GSTM1- and GSTT1-null genotypes by PCR-RFLP and by Multiplex PCR, GST protein level estimation by ELISA method. Results: NLRP1 rs2670660 polymorphism was shown to be in significant association with GV, with the presence of minor alleles in active GV. We found that the frequencies of GSTM1 null genotype and GSTT1 null genotype in vitiligo patients were significantly high compared to the controls (OR= 1.47, 95% CI=0.765--2.861), (OR = 4.75, 95% CI = 2.131-10.63), respectively. In combination analysis with both genes, the results suggested significant association of vitiligo risk with both GSTM1\GSTT1 null genotypes (OR=4.83, 95% CI=1.523– 15.32).We observed a significant decrease (p<0.001) in GST protein levels. Conclusion: Our findings indicate that NLRP1 rs2670660 polymorphism may be genetic risk factor for susceptibility to GV and the null genotypes of GSTM1 and GSTT1 of both genes increase the risk of the disease. A significant decrease (p<0.001) in GST protein levels appeared to be a key feature in Vitiligo subjects, Therefore, detection of antioxidant enzyme levels can be effective biomarkers for early detection of the disease. We believed that GSTM1-and GSTT1-null genotype polymorphisms were associated with an increased risk of vitiligo. This is the first study of its kind along with Clinical Phenotype as per Unani Philosophy.

KEYWORDS: Generalized Vitiligo, NLRP1 gene, GSTM1 and GSTT1 null genotypes, GST.

INTRODUCTION:

Generalized vitiligo is an procured, non-contagious clutter in which dynamic, inconsistent loss of pigmentation from skin, overlying hair, and oral mucosa results from autoimmune loss of melanocytes from the included regions¹. Vitiligo is maybe the foremost common pigmentation clutter, happening in around 0.4% of Caucasians², with a comparative predominance in other populaces. In Unani medication Vitiligo vulgaris is known as Bars, this persistent skin clutter is characterized by dynamic loss of utilitarian melanocytes, which results in depigmented macules in skin, hair, and mucous films. The aetiology of vitiligo is still a riddle. Some ponders on the inclusion of hereditary components controlling vulnerability to vitiligo has been detailed in allopathy, but these reports are displayed as a complex, multifactorial and polygenic malady. The prevailing theories recommends that the patho-mechanisms of the condition are autoimmune, hereditary, neural, and/or biochemical components. Among distinctive types of vitiligo, melanocyte loss in vitiligo vulgaris is presently broadly accepted to be an autoimmune process, and one of the most grounded variables supporting an autoimmune origin of vitiligo vulgaris is its epidemiological affiliation with other immune system maladies^3-7. However evidences are also available of the involvement of genetic factors rendering its susceptibility to vitiligo. In view of such lacunae in knowledge we propose to look at the genetic basis of susceptibility to Bars (vitiligo).

More than 30 GV susceptibility loci have been recognized on the basis of genetic linkage and genome-wide interaction studies (GWAS)⁸. GWAS has revealed a profoundly important correlation in family cases of GV with polymorphic variants of the NLRP1 encoding gene (a key regulator of the innate immune system, previously known as NALP1)^9,10. NLRP1 identifies pathogen-associated molecular patterns and triggers gathering of the NLRP1 inflammasome, which fortifies incendiary responses and apoptotic pathways ensuing in pathogenesis of vitiligo^10,11. The NLRP1 gene is a leucine-rich repeat protein 1 a member of the NLR family (nucleotide oligomerization domain-like receptor) ¹⁰. It contains a caspase enlistment domain that's known to be the key arbitrator of apoptosis. Increased  levels of NLRP1 expression in immune cells, especially  in T cells and Langerhans cells emphasize the part of NLRP1 in regulation of the immune system.¹²

Genetic affiliation of NLRP1 variations with GV has been appeared in populaces within the U.S.A., U.K., Romania and Jordan^9,13,14. Jin et al., 2007¹³ distinguished the 17p gene as NALP1, which encodes NACHT leucine-rich repeat protein 1, a key regulator of the intrinsic immune system¹⁵. NALP1 is a key controller of the intrinsic immune system, functioning as part of the reconnaissance system for infection by microbes or infections. NALP1 is broadly expressed, but is at most elevated levels in Langerhans cells and T cells¹⁶. Recognition of pathogen-associated molecular patterns by NALP1, conceivably muramyl dipeptide¹⁷, is thought to invigorate gathering of the NALP1 inflammasome and subsequently trigger inflammatory and apoptotic pathways¹⁵. SNPs rs2670660 is found inside a huge block of solid LD and together tag at slightest another autonomous association signal. Other than the immunological and pathogenic component, later information propose that oxidative stress may be an critical contributor to the pathogenesis of melanocyte death^18,19. The imbalance between oxidative stress and antioxidation appears to initiate insufficient antioxidation protection or overabundance generation of receptive oxygen species (ROS)^20-27.

Glutathione S-transferase (GST) superfamily consists of the widely expressed phase II isoenzymes participating in the protection against oxidative stress. They catalyze the detoxification of the reactive oxygen regeneration of S-thiolate proteins and the conjugation of glutathione to endogenous and exogenous electrophilic substrates, thus detoxifying a number of electrophilic compounds caused by cell destruction caused by reactive oxygen species ^28,29. Alpha (GSTA), Mu (GSTM), Omega (GSTO), Pi (GSTP), Theta (GSTT), and Zeta (GSTZ) are  the six subfamilies of GST gene family³⁰. GSTM1, GSTT1, and GSTP1 polymorphisms are the best-characterized among them. The GSTM1 and GSTT1 genes are located on chromosomes 1p13.3 and 22q11.23, respectively. Homozygosity of non-functional allele generates GSTM1 null genotype and GST1-null genotype and result in loss of the enzyme activity³¹. However, only a small sample study has been performed in Koreans to explore the association between GSTM1 and GSTT1 gene polymorphisms and vitiligo susceptibility and their observations suggests that only the absence of GSTM1, and not that of GSTT1, was associated with the risk of vitiligo³².

The major objective of this study is to assess the role of NLRP1 gene polymorphism, GST’s and Generalized Vitiligo with Phlegmatic clinical Phenotypes. Secondly, we aim to determine the gene frequency of these two gene polymorphisms (NLRP1 rs2670660 and GSTM1+GSTT1) and to assess their roles in relation to its susceptibility to Generalized Vitiligo.

MATERIALS AND METHODS:

Selection of Study Subjects:

A total of 200 subjects which include100 vitiligo patients and 100 healthy volunteers were selected on the basis of clinical history by Unani physicians from the OPD clinic of National Research Institute of Unani Medicine for Skin Disorders (NRIUMSD) (formerly Central Research Institute of Unani Medicine (CRIUM)), Hyderabad. The study was approved by institutional ethics committee. Family history, clinical features and other triggering factors were noted in the CRF proforma as followed by the Unani system of medicine. In Unani system of Medicine four types of clinical phenotypes or temperaments are observed they are Balghami (Phlegmatic), Damvi (Sanguine), Safravi (Bilious) and Saudavi (Melancholic). Generally in Unani system of medicine Vitiligo is considered to be due to alteration in Balghami temperament i.e increased quantity of phlegm (Balgham) in the blood resulting in impaired nutrition to the skin cells which may lead to loss of melanocytes. Hence, in the current study 200 subjects enrolled all belongs to Balghami (Phlegmatic) temperament only. 100 healthy volunteers served as the control group and they were free of a positive family history of vitiligo and other chronic diseases.

Blood Sample Collection:

Two ml of whole blood was collected by venipuncture from 200 subjects (100 with vitiligo and 100 controls). Blood was collected in sterile syringes and was transferred to K2 EDTA vacutainers. Samples gathered were brought to the laboratory in an ice box. Blood specimens were preserved in the freezer at-4°C for further use. Informed approval was taken from patients as well as healthy volunteers prior to collection of blood samples. Genomic DNA was isolated from peripheral blood samples by using HiPurA™ blood genomic DNA Purification Kit a column based DNA isolation kit, to get high yield. The DNA was dissolved in the Elution buffer, quality and quantity was checked by agarose gel electrophoresis and nanodrop reading by using Multimode reader. DNA was then stored at -20°C until further use.

5ml of venous blood sample was obtained from Vitiligo patients and control subjects in a metal-free sterile tube between 8 a.m. and 9 a.m. following a night of fasting. The blood was then permitted to coagulate at room temperature for 30 minutes and centrifuged for 15 minutes at 5000rpm to extract the serum. The serum was taken in eppendorf tube and stored at −80°C for further until analysis.

Genetic analysis:

PCR amplification and genotype determination of NALP1 Gene- rs 2670660 (A/G):

For genetic studies, PCR amplification and genotype evaluation of NALP1 Gene-rs 2670660 (A/G) was illustrated by polymerase chain reaction (PCR) and restriction of PCR-RFLP fragment length polymorphism processes as shown in Table 1. Relevant primers had been used to amplify the related PCR gene and the reaction products were digested using the enzyme at 60°C. The digested products were analyzed on 2.5% agarose gel stained with ethidium bromide and examined under transillumination. Predicted results after restriction for each gene were seen in Table 1.

PCR amplification and genotype determination of GSTM1 and GSTT1 genes:

Homozygous and null polymorphisms of GSTM1 and GSTT1 have been examined using the modified multiplex PCR method for specific replication of both genes for molecular analysis⁶. The co-amplification of the globulin gene fragment has been used as an internal positive control for a successful amplification response. Related primers have been used to amplify the associated PCR gene and the products were mentioned in Table 2. In the assessment of GST M1 and GST T1 polymorphisms, amplified products were analyzed using gel electrophoresis (1.6% agarose). Negative controls (tubes containing a PCR mixture without a DNA template) were used to detect contamination at each run. PCR amplified the 240 bp fragment with the GST M1 primer, while the 480 bp fragment was amplified with the GST T1 primer. The lack of an amplified substance was associated with zero genotypes. Effective amplification of the β-globulin-specific primers demonstrated the proper functioning of the PCR reaction. The PCR specifications for the determination of GST M1 and GST T1 genotypes were the same as those previously stated^33,34.

Table 1: Primers and restriction enzymes used for NALP1 gene A/G promoter (rs2670660)

Gene/SNP Primer	Sequence (5’ to 3’)	Annealing Temperature (°C)	Amplicon size (bp)	Restriction Enzyme(Digested Products)
( rs2670660) NALP1 A/G F NALP1 A/G R	TGTTTATCCCAGGGCTTCTTGT CAGTGTTCTGTGGAAATGAAAGAG	53	227	ApoI (179 & 48 bp)

Table 2: Primers and PCR products for GSTM1, GSTT1 and β-globulin genes

Gene/SNP Primer	Sequence (5’ to 3’)	Amplicon size(bp)
GST M1 F GST M1 R	5’-GAACTCCCTGAAAAGCTAAAGC-3’ 5’-GTTGGGCTCAAATATACGGTGG-3’	240 bp
GST T1 F GST T1 R	5’-TTCCTTACTGGTCCTCACATCTC-3’  5’-TCACCGGATCATGGCCAGCC-3’.	480 bp
β-globulin	5’GCCCTCTGCTAACAAGTCCTAC-3’ 5’-GCCCTAAAAAGAAAATCGCCAATC-3’	315 bp

Estimation of Serum Glutathione S Transferase Levels by Enzyme-linked Immunosorbent Assay:

Laboratory analysis of GST activity was done by Glutathione S Transferase assay kit (supplied by sigma catalog no CS0410)GST activity  measured 96 well plate wave length of 340nm under standard condition the amount of enzyme conjugating one micromole of 1-chloro-2,4-dinitrobenzene (CDNB) with glutathione (GSH)in one minute was defined as one unit activity (µmol/ml/min).

Biochemical parameters of the study subject’s liver function tests (Bilirubin, ALT, AST and ALP and renal function tests (Urea, Creatinine) were also analysed by using an Erba Auto Analyser.

Statistical Analysis:

Statistical analyses were performed using the Student’s t test. Data are expressed as means + SD. Differences in clinicopathological characteristics between patients and controls were tested by chi-square test for categorical data and Student’s t-test for numerical data. Odds ratio (OR) and 95% confidence interval (CI) for the association between genotype and vitiligo was computed.. A two-sided p-value of less than 0.05 was considered statistically significant. We present here the results of the genetic studies on 100 Vitiligo patients and 100 healthy volunteers with phlegmatic clinical phenotype.

RESULTS:

We present here our results on various biochemical parameters in Balghami subjects suffering from Vitiligo and compared it with the non-vitiligo Balghami healthy controls. Demographic parameters were also recorded for each patient and each control. All the results are presented after statistical analysis in various tables. In this study we found more males than females.

Blood samples collected from the study group (100 patients and 100 controls) were divided into different portions for different types of studies. 1ml sample was used for genotyping studies and the rest for biochemical studies as mentioned above. Similarly the biochemical parameters were also recorded as compared to controls. (Table 3)

Biochemical parameters:

The results of these experiments are presented in Table-3. All the values are within the reference range. (Table-3).

Table 3: Showing various parameters of Vitiligo patients and control subjects:

Parameters	Ref. Values	Controls	Vitiligo patients	p Value
Age		38.4 ± 12.69	36.12 ± 13.07	0.212
BMI		28.76 ± 5.29	25.42 ± 5.87	0.0001
Liver function tests Bilirubin (mg/dl)	0.1-1.2	0.61 ± 0.33	0.75  ± 0.36	0.0046
ALT (IU/L)	0.5-40	22.21  ± 13.50	29.56 ± 24.98	0.0104
AST (IU/L)	0.5-42	21.69  ± 7.37	30.64 ± 26.7	0.0014
ALP (IU/L)	30-111	92.06 ± 73.70	78.52  ± 24.70	0.08
Urea (mg/dl)	13-45	26.0  ± 7.61	24.54 ± 5.63	0.012
Creatinine (mg/dl)	0.7-1.4	1.04  ± 0.21	1.05  ± 0.18	0.718

p >0.05 is considered significant, Values are in mean ± SD, P value by student’s t- test

BMI: body mass index, ALT: Alanine Amino transferase, AST: Aspartate amino transferase. ALP: Alkaline phosphates

Analysis of association between NLRP1 (A/G; rs2670660) promoter polymorphism and susceptibility to generalized vitiligo:

PCR-RFLP for the NLRP1 A/G promoter polymorphism yielded a 227-bp undigested product corresponding to the ‘G’ allele, and 179-bp and 48-bp digested products corresponding to the ‘A’ allele. The NLRP1 A/G promoter polymorphism was found to be in significant association with GV patients (P-<0.0001) when genotypes were compared using the χ² test 3 * 2 contingency table (Table 4). In particular, the minor allele ‘G’ was prevalent in the GV group compared with the control group and this was consistent with a susceptibility effect in the GV group (44.0% vs. 32.0%, P < 0.01, odds ratio (OR) 0.58 (0.39-0.88)(Table 4).

Table 4: Genotype frequency of the rs2670660 polymorphism in NALP1 gene for Balghami vitiligo patients and Balghami controls.

Genotype/Alleles	Vitiligo patients, n (freq.) (n =100)	Healthy controls, n (freq.) (n = 100)	Odds ratio (95% CI)	P for association
AA	31 (0.31)	38 (0.38)		0.008
AG	49 (0.49)	60 (0.60)	0.9989(0.5449-1.831)	0.008
GG	20(0.2)	02(0.02)	0.081(0.017-0.3763)	0.0004
Allele A	111(0.55)	136(0.68)
G	89(0.44)	64(0.32)	0.58(0.39-0.88)	0.01

Analysis of association between GSTM1 and GSTT1 null genotype and susceptibility to generalized vitiligo: In this study, we investigated the effect of GSTM1 and GSTT1null genotypes in 100 vitiligo patients and 100 controls.  The frequencies of GSTM1 null genotype and GSTT1 null genotype in vitiligo patients were significantly compared with the controls (OR= 1.47, 95% CI=0.765--2.861), (OR = 4.75, 95% CI = 2.131-10.63), respectively. In combination analysis with both genes, the results suggested significant association of vitiligo risk with both GSTM1 \ GSTT1 null genotypes (OR=4.83, 95% CI=1.523– 15.32). (Table-5)

Table 5: Genotype frequencies of GSTM1 & GSTT1 genes in vitiligo patients & Balghami controls.

	Vitiligo  patients, n (freq.) (n = 100)	Healthy controls, n (freq.) ( n = 100)	Odds ratio (95%CI)	P for association
GSTM1 Genotypes
GSTM1 Present (+)	73 (0.73)	80 (0.8)	1.0
GSTM1 Null (-)	27 (0.27)	20 (0.2)	1.47(0.76-2.86)	0.3192
Total	100 (0.10)	100 (0.10)
	Vitiligo patients, n (freq.) (n = 100)	Healthy controls, n (freq.) (n = 100)
GSTT1 Genotypes
GSTT1 Present (+)	68 (0.68)	91 (0.91)	1.0
GSTT1 Null (-)	32 (0.32)	09 (0.09)	4.75 (2.13-10.63)	0.00012*
Total	100 (0.10)	100 (0.10)
Combined Genotypes
	Vitiligo patients, n (freq.) (n = 100)	Healthy controls, n (freq.) ( n = 100)
GSTM1 (+),GSTT1 (+)	59 (0.59)	76 (0.76)	1.0
GSTM1(-), GSTT1(-)	15 (0.15)	04 (0.04)	4.83 (1.52-15.32)	0.0159*
Others	26 (0.26)	20 (0.2)
	100 (0.10)	100 (0.10)

Levels of Glutathione S-transferase (GST):

A significant decrease in the level of GST in Vitiligo subjects (p=<0.001) in contrast to controls was observed. (Table-6).

Table 6: Serum concentration levels of Glutathione S transferase in Balghami Vitiligo patients and Balghami controls.

Parameters	Control group(n=100)	Patients (n=100)	P-value
Glutathione S transferase(µmol/ml/min)	0.66±0.12	0.54±0.09	0.001

Data are expressed as mean ±SD, p value <0.05 was considered statistically significant.

DISCUSSION:

NLRP1 is known to be included in aggravation and apoptosis ^35,36. It balances the reaction of cells towards proinflammatory cytokines such as interleukin (IL)-1b, interferon (IFN)-c and tumor necrosis factor (TNF)-a. In addition, it has been proposed that melanocyte death is intervened by apoptosis in the context of autoimmunity, and cytokines such as IFN-c, TNF-a and IL-1b can initiate apoptosis ³⁷. Recent studies appeared that over expression of the NLRP1 gene actuates apoptosis in cells and indeed transient over expression of NLRP1 in in-vitro cultured cells was sufficient to induce apoptosis ¹⁶. NLRP1 is a component within the active gathering of inflammasomes ³⁸. The NLRP1 inflammasome actuates caspase-1, which in turn enacts proinflammatory cytokines IL-1b and IL-18 ³⁹. NLRP1 is expressed at low levels in all cells but is expressed at high levels in blood mononuclear cells and immune cells, especially granulocytes, monocytes, T lymphocytes and Langerhans cells.

Immunohistochemical experiments have demonstrated a high expression of NLRP1 of the epidermis in Langerhans cells, indicating the role of NLRP1 in skin autoimmunity. NLRP1 can also induce or promote autoimmunity as crosstalk occurs between melanocytes and NLRP1-positive Langerhan cells. ⁴⁰ . Previously, numerous SNPs in NLRP1 have been studied in relation to GV susceptibility; however, only a fraction of them have achieved a substantial association. ^10,13,14 .  The conceptual importance of these SNPs is not yet understood, but they are proposed to have a regulatory effect on NLRP1 expression ^8,10. An important association with GV of two SNPs in the NLRP1 extended promoter region (rs1008588 and rs2670660) was also shown in an Arab population ¹⁴. The present research focuses on the detection of genetic variants of NLRP1 that have been found to be strongly correlated with GV susceptibility in earlier studies. Interestingly, we find an important correlation of NLRP1 rs2670660 (A/G) PNS with GV susceptibility in the South Indian community with phlegmatic clinical phenotype; Furthermore, the ‘G’ allele of promoter polymorphism (A/ G; rs2670660), which may be involved in regulation of NLRP1 expression, was found to be prevalent in GV. This is the first kind of work combining gene polymorphism and phlegmatic clinical phenotyping in Vitiligo.

GSTs have a critical part to play in the defense against oxidative stress. Homozygosity for null alleles or those encoding low-activity variants can be associated with detrimental biochemical implications; thus, polymorphisms in GSTs are linked with increased vulnerability to oxidative stress-related diseases such as cancer, diabetes, asthma, Parkinson's disease and may also be associated with rosacea, UV sensitivity, atopic dermatitis, and vitiligo ^26,41,42. In this analysis, we observed that the GSTM1 and GSTT1 null genotype had a strong correlation with vitiligo disease. These findings were accepted with Liu et al., (2009)⁴³ who proposed that GSTT1-null genotype and GSTM1-null genotype interaction with vitiligo susceptibility. In combined analysis, both GSTM1-null and GSTT1-null genotypes showed significant association with vitiligo. These results agreed with the study by Liu et al., and Abd Rabou et al., (2009) ^43,44  as they showed the same significant association. Whereas, we have also assessed the clinical phenotypes which were all phlegmatic as per unani philosophy. The GSTM1 and GSTT1 null genotype leading to impairment in the antioxidant system in vitiligo, this is in turn leading to excess free radical which causes destruction of melanocytes or dysregulation of melanogenesis and activates an autoimmune response.Similarly we found that GST levels were also significantly low (p->0.001) in vitiligo patients. Glutathione-s-transferases (GST) also perform a variety of other roles – peroxidase and isomerase activity – which can inhibit JunN terminal kinase, thereby shielding cells from H2O2 mediated cell death. They are capable of binding non-catalytically endogenous and exogenous ligands.

In conclusion, the pathogenesis of vitiligo is proposed to be coupled with many factors as environmental and genetic factors. This is the first kind of study in relation to clinical phenotyping as per Unani philosophy. We are of the opinion that in Phlegmatic Vitiligo patients the NLRP1, GSTM1 and GSTT1 null genotypes play an significant role in the pathogenesis of vitiligo. Null genotype of both genes increase a risk of the disease, because of the deficiency of the antioxidant system caused by the lack of GSTM1 and GSTT1 cannot be easily recovered. A significant decrease (p<0.001) in GST levels appeared to be a key feature in Vitiligo subjects, therefore detection of levels of antioxidant enzymes can be valuable biomarkers for early diagnosis.. Future studies may focus on the functional analyses of these genes in disease susceptibility. Due to unregulated bias in the selection of participants and small sample size, larger and population-based research, including further single-nucleotide polymorphisms in genes implicated in oxidative stress, are necessary to further validate these results.

ACKNOWLEDGEMENT:

The authors acknowledge the support of the Director General, CCRUM. We are also grateful to the study group for their co-operation.

REFERENCES:

1. Azmi-Ahmad Altaf: Basic concepts of Unani medicine a-critical study.

2. Hameed Abdul H.K. “A Temperament and Medicine” International Congress of Orientalists, Paris, 1973.

3. Nafis Burhan-al-din, Kulyat-e-Nafisi Vol.2, Daftar-alMasihi, Delhi, 1935.

4. R. Vinodini, A. M. Amala Hazel, M. Meenakshi Sundaram, N. J. Muthukumar. Clinical Evaluation of Parangipattai chooranam (internal) and Annabedhi chenduram (external) for Venpulli (Vitiligo) in children. Research J. Pharm. and Tech. 2019; 12(12): 5932-5936. doi: 10.5958/0974-360X.2019.01029.1.

5. Hameed Abdul and Vohra, S.B. Is Human Body A Microcosm Paper presented at international Conference, New Delhi, 1987.

6. Grimes P, Nordlund JJ, Pandya AG, Taylor S, Rendon M, Ortonne JP. J Am Acad Dermatol. Increasing our understanding of pigmentary disorders. 2006 May;54 (5 Suppl 2):S255-61.

7. Howitz J, Brodhagen H, Schwartz M, Thomsen K. Prevalence of vitiligo. Arch Dermatol 1977; 113:47-52. 

8. Kemp, EH. Waterman, EA.,Weetman, AP. Autoimmune aspects of vitiligo. Autoimmunity; 2001; 34: 65-77, doi:10.3109/08916930108994127.

9. Rezaei, N., Gavalas, NG., Weetman, AP., Kemp, EH.Autoimmunity as an aetiological factor in vitiligo. J Eur Acad Dermatol Venereol; 2007; 21: 865-876, doi: 10.1111/ j.1468-3083.2007.02228.x.

10. Spritz, RA. The genetics of generalized vitiligo and associated autoimmune diseases. Pigment Cell Res; 2007; 20:271-278, doi: 10.1111/j.1600-0749.2007.00384.x.

11. Shajil, EM., Chatterjee, S., Agrawal, D., Bagchi, T., Begum, R, Vitiligo: pathomechanisms and genetic polymorphism of susceptible genes.; Indian J ExpBiol; 2006, 44: 526-539.

12. Ingordo, V., Gentile, C., Iannazzone, SS., Cusano, F., Naldi, L Vitiligo and autoimmunity: an epidemiological study in a representative sample of young Italian males J Eur Acad Dermatol Venereol. 2011; 25: 105-109, doi: 10.1111/j.1468-3083.2010.03696.x.

13. Jin Y, Birlea SA, Fain PR et al. Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. Nat Genet 2012; 44:676–80.

14. Ting JP, Willingham SB, Bergstralh DT. NLRs at the intersection of cell death and immunity. Nat Rev Immunol 2008; 8:372–9.

15. Jin Y, Mailloux CM, Gowan K et al. NALP1 in vitiligo-associated multiple autoimmune disease. N Engl J Med 2007; 356:1216–25.

16. Church LD, Cook GP, McDermott MF. Primer: inflammasomes and interleukin 1 beta in inflammatory disorders. Nat Clin Pract Rheumatol 2008; 4:34–42.

17. Ting JP, Davis BK. Caterpiller: a novel gene family important in immunity, cell death, and diseases. Annu Rev Immunol 2005; 23:387–414.

18. Jin Y, Birlea SA, Fain PR et al. Genetic variations in NALP1 are associated with generalized vitiligo in a Romanian population. J Invest Dermatol 2007; 127:2558–62.

19. Alkhateeb A, Qarqaz F. Genetic association of NALP1 with generalized vitiligo in Jordanian Arabs. Arch Dermatol Res 2010; 302:631–4.

20. Gregersen PK. Modern genetics, ancient defences, and potential therapies. N Engl J Med. 2007;356(12):1263–6. Epub pmid:17377166

21. Kummer JA, Broeckhuizen R, Everett H et al. Inflammasome components NALP1 and 3 show distinct but separate expression pro- files in human tissues, suggesting a site-specific role in the inflammatory response. J Histochem Cytochem 2007; 55:443–52.

22. Faustian B, Lartigue L, Bruey JM, Luciano F, Sergienko E, Bailly-Maitre B, Volkmann N, Hanein D, RouillerI, Reed JC. Reconstituted NALP1 inflammasome reveals two-step mechanism of caspase-1 activation. Molecular Cell, 2007, 25(5):713-24

23. Bickers DR, Athar M . Oxidative stress in the pathogenesis of skin disease. J Invest Dermatol; 2006, 126:2565–75.

24. Dell’Anna ML, Ottaviani M, Albanesi V, Vidolin AP, Leone G, Ferraro C et al.  Membrane lipid alterations as a possible basis for melanocyte degeneration in vitiligo. J Invest Dermatol, 2007; 127:1226–33.

25. Passi S, Grandinetti M, Maggio F, Stancato A, De Luca C . Epidermal oxidative stress in vitiligo. Pigment Cell Res 1998,11:81–5.

26. Sneha James, Krishnan Namboori P K, Leena K Pappachen. Glutathione Derivatives as Potential Drugs for Colorectal Cancer Resulted by APC Mutations. . Research J. Pharm. and Tech, 2019 , 12 (8) :  3911-3914.  doi: 10.5958/0974-360X.2019.00673.5.

27. Jimbow K, Chen H, Park JS, Thomas PD.  Increased sensitivity of melanocytes to oxidative stress and abnormal expression of tyrosinaserelated protein in vitiligo. Br J Dermatol 2001;144:55–65.

28. Tulsi Rani Thakre, Abha Singh, Mitashree Mitra. Investigation on Glutathione-S-transferase M1 and T1 gene polymorphisms as risk factor in Cervical Cancer. Research J. Pharm. and Tech 2016; 9(12):2295-2300. doi: 10.5958/0974-360X.2016.00462.5.

29. Koca R, Armutcu F, Altinyazar HC, Gurel A . Oxidant-antioxidant enzymes and lipid peroxidation in generalized vitiligo. Clin Exp Dermatol 2004; 29:406–9.

30. Ines D, Sonia B, Riadh BM, Amel el G, Slaheddine M, Hamida T et al.  A comparative study of oxidant-antioxidant status in stable and active vitiligo patients. Arch Dermatol Res, 2006; 298:147–52.

31. Shiv Kumar Patel, Moumita Sinha, Mitashree Mitra. Glutathione-S-transferase M1 and T1 gene Polymorphism as Risk Factors of Oral Squamous Cell Carcinoma: A Preliminary Investigation. Research J. Pharm. and Tech. 2012; 5(7): Page 918-920.

32. Arican O, Kurutas EB . Oxidative stress in the blood of patients with active localized vitiligo. Acta Dermatovenerol Alp Panonica Adriat, 2008,17:12–6.

33. Huda Kadhem Mohseen, Baydaa Taher Sih, Sura Salah Al-Saidi. Effect of the (ɣ-ray) and Laser Radiation on the Important Antioxidant Enzyme Glutathione(GSH) level in Serum. Research J. Pharm. and Tech 2017; 10(10):3386-3390. doi: 10.5958/0974-360X.2017.00602.3.

34. Xiao Z, Yang L, Xu Z, Zhang Y, Liu L, Nie L et al. Glutathione S-transferases (GSTT1 and GSTM1) genes polymorphisms and the treatment response and prognosis in Chinese patients with de novo acute myeloid leukemia. Leuk Res,2008; 32:1288–91.

35. Martinon F, Tschopp J. NLRs join TLRs as innate sensors of pathogens. Trends Immunol 2005; 26:447–54.

36. Tschopp J, Martinon F, Burns K. NALPs: a novel protein family involved in inflammation. Nat Rev Mol Cell Biol 2003; 4:95–104.

37. Huang CL, Nordlund JJ, Boissy R. Vitiligo: a manifestation of apoptosis. Am J Clin Dermatol 2002; 3:301–8.

38. Martinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 2002; 10:417–26.

39. Van de Veerdonk FL, Netea MG, Dinarello CA, Joosten LA. Inflammasome activation and IL-1b and IL-18 processing during infection. Trends Immunol 2011; 32:110–16.

40. Taieb A. NALP1 and the inflammasomes: challenging our perception of vitiligo and vitiligo-related autoimmune disorders. Pigment Cell Res 2007; 20:260–2.

41. Kerb R, Brockmoller J, Reum T, Roots I. Deficiency of glutathione S-transferases T1 and M1 as heritable factors of increased cutaneous UV sensitivity. J Invest Dermatol, 1997; 108:229–32

42. Vavilin VA, Safronova OG, Lyapunova AA, Lyakhovich VV, Kaznacheeva LF, Manankin NA et al.  Interaction of GSTM1, GSTT1, and GSTP1 genotypes in determination of predisposition to atopic dermatitis. Bull Exp Biol Med, 2003; 136:388–91

43. Liu, L., Li, C., Gao, J., Li, K., Gao, L., Gao, T. Genetic polymorphisms of glutathione S-transferase and risk of vitiligo in the Chinase population. J. Invest Dermatol., 2009, 129: 2646-2652.

44. Abd Rabou, F., Elserogy, H., Gheida, S., EL-Ashmawy, A. Glutathione S-Transferase Gene Polymorphisms (GSTM1 and GSTT1) in Vitiligo Patients. Life Sci J 2011; 8(4): 785-792.

Received on 17.03.2021           Modified on 04.05.2021

Accepted on 22.07.2021         © RJPT All right reserved

Research J. Pharm. and Tech. 2022; 15(5):2221-2227.

DOI: 10.52711/0974-360X.2022.00369